TPWW Forums  

Go Back   TPWW Forums > w r e s t l i n g > wrestling forum

Reply
 
Thread Tools Display Modes
Old 02-07-2007, 04:21 PM   #2201
Inadequacy
I'm nauseous
 
Inadequacy's Avatar
 
Posts: 1,994
Inadequacy is good (20,000+)Inadequacy is good (20,000+)Inadequacy is good (20,000+)Inadequacy is good (20,000+)Inadequacy is good (20,000+)Inadequacy is good (20,000+)Inadequacy is good (20,000+)Inadequacy is good (20,000+)
Some porn actress: Hey Khali! I'm filming a stomp video today, but I think I sprained my ankle so I was wondering if you wanted to cover for me.

Boy, sometimes I regret having friends who tell me about stuff like that.
Inadequacy is offline   Reply With Quote
Old 02-07-2007, 04:28 PM   #2202
Xero
He's Here
 
Xero's Avatar
 
Posts: 60,735
Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)
Khali: I CHOPPY CHOPPY YOUR PEE PEE!

*Chop*

Val: SHRRRIIIINNNKKKAAAGGGGEEEEEE!
Xero is offline   Reply With Quote
Old 02-07-2007, 04:47 PM   #2203
Indifferent Clox
emerge
 
Indifferent Clox's Avatar
 
Posts: 16,710
Indifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be banned
Dave Chappelle as Rick James:
WHAT DID KHALI'S FINGERS SAY TO THE FACE?

KHALI: AUGUAUGUAGUUGUAGUGAUGUAGUGUA!
*CHOP*
Indifferent Clox is offline   Reply With Quote
Old 02-07-2007, 06:46 PM   #2204
Lock Jaw
Is Finkle
 
Lock Jaw's Avatar
 
Posts: 88,960
Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)
Lillian Garcia: And now introducing... MUHAMMED HASSA-

AYYLEEAAAAAAHAYLEEEAHHAYLEEEEEEEEEEEEEEE - ARRRRRGHBG!! *KHALI CHOP'D*

Hassan: Dammit, Khali!
Lock Jaw is offline   Reply With Quote
Old 02-07-2007, 07:18 PM   #2205
Indifferent Clox
emerge
 
Indifferent Clox's Avatar
 
Posts: 16,710
Indifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be banned
New Hogan Khalie tag theme music:

*WHEN IT COMES CRACKING DOWN LIKE A KHALI CHOP*
BUM BUM BUM BUM BUMBUM BUM BUM
*AUAUAUAUAH AIAUIAUIUAIU AUIAUIUI*
BUM BUM BUM BUM BUM BUM BUM
Indifferent Clox is offline   Reply With Quote
Old 02-07-2007, 07:33 PM   #2206
El Fangel
ELF ANGEL
 
El Fangel's Avatar
 
Posts: 39,476
El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)


Khali arrives home

Khali's mom: What did you learn today Khali
Khali GUIGIBKJ NIHGVUHBKJNJIBVkl JHJIBJO NKLMKMNPMPM ( I learned how to chop onions)
Mom: Thats nice dear, but I already chopped the onions
Khali: KJOJNBHBUIBLIJNGVBKU JHUIHLIHUNOIMN UIUILINULNBL ( I dislike onions very much, they upset my stomach)
Mom: Well your going to eat them
*CHOP*
Khali: UJHUIHLUIBIBIU (Momma? Looks at watch, 20 minutes to dinner)
*CHOP*
Khali: ZZZZZZZZZZZZZZZZZZZZZZ
El Fangel is offline   Reply With Quote
Old 02-07-2007, 10:16 PM   #2207
Lock Jaw
Is Finkle
 
Lock Jaw's Avatar
 
Posts: 88,960
Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)Lock Jaw makes a lot of good posts (200,000+)
Lita: Khali... I'm pregnant.
Khali: URRRAAGGGGGGGUUUUBBBB!! *CHOP!*
Lita: Dammit, not again.
Lock Jaw is offline   Reply With Quote
Old 02-07-2007, 10:44 PM   #2208
Impact!
R.I.P Tanner
 
Impact!'s Avatar
 
Posts: 8,219
Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)
*In a WWE creative meeting*

Vince: Alright guys, what have we got planned for the upcoming months

Writer 1: Well Vince, first up we're gonna have Hulk Hogan and Steve Austin return at Wrestlemania

Vince: Excellent, what are they goin to do there.

Writer 2: Well first of all Hogan is going to cost Carlito, CM Punk, RVD, Jeff Hardy, Ken Kennedy and Shawn Micheals there matches at mania.

Writer 1: While Austin is going to laugh at them when they return backstage, then he's going to go out and cost Undertaker his streak at Mania.

Vince: This sounds brilliant. Now I just hope you're going to tell me this will go no where, and everyone who got screwed won't be able to regain there heat.

Writer 2: Of course, anything else would just be stupid.

Vince: *Nods* Alright, and while we're at it lets have Hogan go out and defeat MNM & The Hardy Boyz in a handycap match in three minutes.

Writer 1: Why not two minutes?

Vince: Even better. Alright let's get go *CHOP*

Khali: RARGAGRBAJFSDKDTNGJFKDFJ:FHDJ
Impact! is offline   Reply With Quote
Old 02-07-2007, 11:25 PM   #2209
rob11
 
rob11's Avatar
 
Posts: 1,304
rob11 is a chill bro (7,500+)rob11 is a chill bro (7,500+)rob11 is a chill bro (7,500+)rob11 is a chill bro (7,500+)rob11 is a chill bro (7,500+)
Master Shake, and Carl are standing there talking

Master Shake:And I said, to the guy, what's the most the most random thing that can happen right now?

*Khali comes out of nowhere "RARGGRARGARGARG" and chops Carl in half*

Master Shake: That same thing happened!
rob11 is offline   Reply With Quote
Old 02-08-2007, 03:24 AM   #2210
Impact!
R.I.P Tanner
 
Impact!'s Avatar
 
Posts: 8,219
Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)
*Rob Van Dam is in the ECW locker room getting ready to smoke some weed*

RVD: Hey Sabu dude, you in?

Sabu: Does a bear shit in the woods?

RVD: Haha dude of course

Sabu: Just chop the weed dude

RVD: Will do...ah shit did I leave my scissors at Stephanie's again...

Sabu: No way dude, not agian

RVD: Yeah dude, What are we gonna do

*Khali walks into the locker room*

Khali: RARRAHRDMFJSDFSLKDBGFJFKAFJGJF

*Chop*

*Khali leaves*

RVD: ...Hey Sabu you ok

Sabu: X_X

RVD: Dude your totally right, I can cut the weed with one of your ribs, thanks Khai dude.

[end]
Impact! is offline   Reply With Quote
Old 02-08-2007, 04:37 AM   #2211
FourFifty
As over as Crystal Pepsi
 
FourFifty's Avatar
 
Posts: 21,639
FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)
Ted Turner: I need a new way to promote the Atlanta Braves.... but how....
Kahli: BHLRHARHARHAOMFGWTGHEHAT!!!!!
Ted Turner: Of course! I'll hire a 7'4" guy that does a chop!
FourFifty is offline   Reply With Quote
Old 02-08-2007, 04:39 AM   #2212
FourFifty
As over as Crystal Pepsi
 
FourFifty's Avatar
 
Posts: 21,639
FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)
Quote:
Originally Posted by Impact!
first up we're gonna have Hulk Hogan and Steve Austin return at Wrestlemania
Quote:
Originally Posted by Xero
WHAT THE FUCK?

Thank you for ruining Austins return, thank you for ruining what would have been my only mark out moment in a year.

WHY THE HELL WOULD YOU TYPE "SPOILERS" WHEN YOU TYPE WHAT THE SPOILER IS RIGHT BESIDE IT!!!!!!!!!

Now I know Austin is confirmed, he is my favourite wrestler, hearing his damn music hit would have made me mark out so bad, but no, you have to fucking ruin it, couldn't you make the title "Wrestlmania 22 major spoilers" alone? Seriously man, use your goddam brain. Why mark for spoilers when the spoiler is right beside where you mark for spoilers.

Fuck this shit, you're not the only one who does it, so many people do, i am out of the fucking wrestling forum besides for tipsters until Wrestlemania is over, see you all April fourth.
FourFifty is offline   Reply With Quote
Old 02-08-2007, 06:41 AM   #2213
Impact!
R.I.P Tanner
 
Impact!'s Avatar
 
Posts: 8,219
Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)
*Chop*
Impact! is offline   Reply With Quote
Old 02-08-2007, 08:21 AM   #2214
PorkSoda
Diabetes Coming To Getcha
 
PorkSoda's Avatar
 
Posts: 6,826
PorkSoda puts the "bang" in Bangladesh (30,000+)PorkSoda puts the "bang" in Bangladesh (30,000+)PorkSoda puts the "bang" in Bangladesh (30,000+)PorkSoda puts the "bang" in Bangladesh (30,000+)PorkSoda puts the "bang" in Bangladesh (30,000+)PorkSoda puts the "bang" in Bangladesh (30,000+)PorkSoda puts the "bang" in Bangladesh (30,000+)PorkSoda puts the "bang" in Bangladesh (30,000+)PorkSoda puts the "bang" in Bangladesh (30,000+)
George Bush: Iraq is a country, and they are evil. They MUST be stopped. Fool me once, shame on.....my wife? Whatever the nursery rhyme is. Saddam Hussein is my enemy. And your enemy. The enemy is a powerful thing, and we must do our best to deprive him of his accomplishments. The cabinet is here to support me in my decisions, so let us support me with honor, and I will support America with my leadership and we will stop Saddam and his terrorist accusations. When we go to the store, do we pick out hand grenades and gu....

Khali: MAKE SENSE!

CHOP
PorkSoda is offline   Reply With Quote
Old 02-08-2007, 03:13 PM   #2215
Corkscrewed
 
Corkscrewed's Avatar
 
Posts: 18,357
Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)
I give myself 1000 pts. Thanks to those who pushed me over 50,000 rep points.


How Aurora Rose McMahon Helmsley will debut in the WWE.
Corkscrewed is offline   Reply With Quote
Old 02-08-2007, 06:59 PM   #2216
rob11
 
rob11's Avatar
 
Posts: 1,304
rob11 is a chill bro (7,500+)rob11 is a chill bro (7,500+)rob11 is a chill bro (7,500+)rob11 is a chill bro (7,500+)rob11 is a chill bro (7,500+)
Vince: Hey Val.....
rob11 is offline   Reply With Quote
Old 02-08-2007, 07:03 PM   #2217
Xero
He's Here
 
Xero's Avatar
 
Posts: 60,735
Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)
*A hand pops out of a grave*

Baby's Voice: Oh Gene... I'm BAAAACCCK!

(Yeah, it's a rehash from a long while ago.)
Xero is offline   Reply With Quote
Old 02-08-2007, 08:39 PM   #2218
Indifferent Clox
emerge
 
Indifferent Clox's Avatar
 
Posts: 16,710
Indifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be banned
Viscera: Hey sexy
Mae: oh baby
Two weeks later
Mae: I'm giving birth!
Hand pops out

Khali enters the ring
*Chop*
baby comes out of viscera's ass
Vince comes out
Vince: kiss my ass Aurora or you're fired!

Kane comes out

Kane: that's my baby from the rape!
Triple H: No it's mine from when I had sex with Katie Vick
TNA and ROH run out: No it's all of our babies from the 'massive have sex with vince to be jobbed on heat' orgy

JR: BAHGAWD it's a slobber knocker
King: Puppies!
Joey Styles: OH MY GOD!
Tazz: Here comes the Paine!
JBL: Back when I was wrestling I would have kicked the baby
Snitsky: It's not my fault!
Undertaker:GONG!
Michael Cole: I'm WHITE!
The Rock: If you smelllll what the doesn't matter candy ass
Austin: Cause Stone Cold 3:16 said so

Hulk Hogan: enters the ring and leg drops the baby but the baby no sells it and pins Hogan

Triple H: we ain't jobbing to you Hogan this is a new era

Stephanie via trinatron: It's not your baby paul
Shane also from trinatron: I'm the dad!

HAHAUAHAHHAHAHALLALALHALAHAHLHALHALAHLAHLA

THIS Post JUST GOT HASSANED!

Last edited by Indifferent Clox; 02-08-2007 at 09:40 PM.
Indifferent Clox is offline   Reply With Quote
Old 02-08-2007, 09:19 PM   #2219
FourFifty
As over as Crystal Pepsi
 
FourFifty's Avatar
 
Posts: 21,639
FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)
Quote:
Originally Posted by Indifferent Clox
HAHAUAHAHHAHAHALLALALHALAHAHLHALHALAHLAHLA

THIS THREAD JUST GOT HASSANED!
I'm sure this thread has been hassaned by people who are cooler than you.
FourFifty is offline   Reply With Quote
Old 02-08-2007, 09:21 PM   #2220
Xero
He's Here
 
Xero's Avatar
 
Posts: 60,735
Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)
Pretty sure we did a whole Hassan-related Scene.
Xero is offline   Reply With Quote
Old 02-08-2007, 10:06 PM   #2221
FourFifty
As over as Crystal Pepsi
 
FourFifty's Avatar
 
Posts: 21,639
FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)FourFifty got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)
It took me a whole five mins, but someone cooler hassaning this thread.

Quote:
Originally Posted by Xero Limit 126
*Vince is watching CNN*

Reporter in middle east: And today is the inaugur-

Background: (Religious Muslim chant)

Reporter in studio: Looks like they interrupted you there... Let's go to the stage...

Vince: Hmmmmmmm...

(One week later.)

ALYALEEALYALALLAEAAAAAAA!
FourFifty is offline   Reply With Quote
Old 02-09-2007, 02:33 AM   #2222
Corkscrewed
 
Corkscrewed's Avatar
 
Posts: 18,357
Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)
Quote:
Originally Posted by Indifferent Clox
Viscera: Hey sexy
Mae: oh baby
Two weeks later
Mae: I'm giving birth!
Hand pops out

Khali enters the ring
*Chop*
baby comes out of viscera's ass
Vince comes out
Vince: kiss my ass Aurora or you're fired!

Kane comes out

Kane: that's my baby from the rape!
Triple H: No it's mine from when I had sex with Katie Vick
TNA and ROH run out: No it's all of our babies from the 'massive have sex with vince to be jobbed on heat' orgy

JR: BAHGAWD it's a slobber knocker
King: Puppies!
Joey Styles: OH MY GOD!
Tazz: Here comes the Paine!
JBL: Back when I was wrestling I would have kicked the baby
Snitsky: It's not my fault!
Undertaker:GONG!
Michael Cole: I'm WHITE!
The Rock: If you smelllll what the doesn't matter candy ass
Austin: Cause Stone Cold 3:16 said so

Hulk Hogan: enters the ring and leg drops the baby but the baby no sells it and pins Hogan

Triple H: we ain't jobbing to you Hogan this is a new era

Stephanie via trinatron: It's not your baby paul
Shane also from trinatron: I'm the dad!

HAHAUAHAHHAHAHALLALALHALAHAHLHALHALAHLAHLA

THIS Post JUST GOT HASSANED!
Oh gawd that hurt my head more than a Slater C-Fed promo.
Corkscrewed is offline   Reply With Quote
Old 02-14-2007, 12:25 AM   #2223
Indifferent Clox
emerge
 
Indifferent Clox's Avatar
 
Posts: 16,710
Indifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be bannedIndifferent Clox should probably be banned
It was supposed to be stupid, like master shake sort of humor.
Indifferent Clox is offline   Reply With Quote
Old 02-14-2007, 12:52 AM   #2224
El Fangel
ELF ANGEL
 
El Fangel's Avatar
 
Posts: 39,476
El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)


Aurora Rose Age 2
Jan 1st 2008
Given full creative control of WWE storylines.
Jan 8th 2008
Vince on Raw : It seems our ratings jumped 5 points... Aurora you FIRED!
El Fangel is offline   Reply With Quote
Old 02-14-2007, 05:23 AM   #2225
Corkscrewed
 
Corkscrewed's Avatar
 
Posts: 18,357
Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)
If you could use Kurt Angle logic in everyday life...
Corkscrewed is offline   Reply With Quote
Old 02-14-2007, 12:06 PM   #2226
Chuck Jones
The Thread Killer
 
Posts: 477
Chuck Jones has more than 1,000 rep points (1,000+)Chuck Jones has more than 1,000 rep points (1,000+)
Chuck Jones: You are holding me back teacher. Yes, I am an A Student and treated better than the class, but with my last essay, you won't let me spread my wings. I wrote your midterm with a Broken Freaking Neck! A Broken Freaking Neck!
Chuck Jones is offline   Reply With Quote
Old 02-15-2007, 05:19 AM   #2227
Impact!
R.I.P Tanner
 
Impact!'s Avatar
 
Posts: 8,219
Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)
*in a hospital*

Doctor: Sir, I'm afraid you were in a car crash...I'm sorry to inform you that you've broken your neck

Impact!: WITH A BROKEN FRIGGEN NECK
Impact! is offline   Reply With Quote
Old 02-21-2007, 08:14 AM   #2228
Impact!
R.I.P Tanner
 
Impact!'s Avatar
 
Posts: 8,219
Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)
Shane McMahon: Ah Dad, I think we might need to do some serious remodelling with our current direction at this moment...have you looked at the ratings lately?

Vince McMahon: HAVE I LOOKED AT THE RATINGS LATELY, ARE YOU KIDDING ME? WE'RE DRAWING IN 70 BILLION VIEWERS EVERY WEEK, THANKS ALONE TO MYSELF

Shane: ...Dad where'd you get those ratings...

Vince: From the internet...WITH A BROKEN FRIGGING CONNECTION
Impact! is offline   Reply With Quote
Old 02-21-2007, 10:17 PM   #2229
Corkscrewed
 
Corkscrewed's Avatar
 
Posts: 18,357
Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)Corkscrewed has 75,000 or more rep points (75,000+)
2000 pts to Impact.


Rejected choices to be Trump's WM representative.
Corkscrewed is offline   Reply With Quote
Old 02-21-2007, 10:31 PM   #2230
ChiefStubbs
More carbs & half the fat
 
ChiefStubbs's Avatar
 
Posts: 268
ChiefStubbs does not have that much rep yet (10+)
Vince: So Donald, who can you *possibly* pick to take on Umaga?
*Mae Young's music hits*
ChiefStubbs is offline   Reply With Quote
Old 02-21-2007, 10:39 PM   #2231
rob11
 
rob11's Avatar
 
Posts: 1,304
rob11 is a chill bro (7,500+)rob11 is a chill bro (7,500+)rob11 is a chill bro (7,500+)rob11 is a chill bro (7,500+)rob11 is a chill bro (7,500+)
Trump: So you, Chris Jericho, can promise me the services of Goldberg for the big match for 1 million dollars.
Jericho: Sure, "Goldberg" will show up *laughs under breath*
rob11 is offline   Reply With Quote
Old 02-21-2007, 10:54 PM   #2232
Skippord
I'm Mr. White Christmas
 
Skippord's Avatar
 
Posts: 44,526
Skippord makes a lot of good posts (200,000+)Skippord makes a lot of good posts (200,000+)Skippord makes a lot of good posts (200,000+)Skippord makes a lot of good posts (200,000+)Skippord makes a lot of good posts (200,000+)Skippord makes a lot of good posts (200,000+)Skippord makes a lot of good posts (200,000+)Skippord makes a lot of good posts (200,000+)Skippord makes a lot of good posts (200,000+)Skippord makes a lot of good posts (200,000+)Skippord makes a lot of good posts (200,000+)Skippord makes a lot of good posts (200,000+)Skippord makes a lot of good posts (200,000+)
Vince: Who will you pick Donald

Donald: THIS MAN: Photobucket - Video and Image Hosting
Skippord is offline   Reply With Quote
Old 02-21-2007, 11:39 PM   #2233
Shadow
Shadow Conspircy leader
 
Shadow's Avatar
 
Posts: 18,582
Shadow got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)Shadow got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)Shadow got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)Shadow got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)Shadow got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)Shadow got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)Shadow got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)Shadow got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)Shadow got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)Shadow got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)Shadow got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)Shadow got the bus to Rep Town and repped it up real bad at the rep shop (100,000+)
Trump: So you can probably get the job done and beat Umaga so I can shave Vince bald?

Heindenrich: Not only will I beat Umaga...but I'll take him into the lcoker room and...read him a poem. Just like I did to Cole.
Shadow is offline   Reply With Quote
Old 02-22-2007, 12:50 AM   #2234
El Fangel
ELF ANGEL
 
El Fangel's Avatar
 
Posts: 39,476
El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)
Donald: Ok if you win the match, I will pay you half of my ne worth
*Cena wearing a superman costume walks in*
Will you get a haircut?
Donald: No....Why
*Cena flys away*
Donald: Any more takers
Khali: GIGIUGBYBVYTVYTVCTC
Donald: Ummm....OK
Khali (Nods head vigorously) GVBIBIBUNNJKINI
Donald: you want something?
Khali: *CHOP*
*Grabs Donalds Wallet and Leaves*
Runs into Cryme Tyme
CT: Muthafucka beat us to it!
Ron Simmons: DAMN!
*CHOP*
El Fangel is offline   Reply With Quote
Old 02-22-2007, 01:28 AM   #2235
Impact!
R.I.P Tanner
 
Impact!'s Avatar
 
Posts: 8,219
Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)
Donald Trump: And now, introducing my representative...




















AURURA ROOOOOOOOOOOOOOOOOOOOSE
Impact! is offline   Reply With Quote
Old 02-22-2007, 01:29 AM   #2236
El Fangel
ELF ANGEL
 
El Fangel's Avatar
 
Posts: 39,476
El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)El Fangel makes a lot of good posts (200,000+)
I know that kid would be a heel, no fucking way it could be a baby face.
El Fangel is offline   Reply With Quote
Old 02-22-2007, 02:59 AM   #2237
Impact!
R.I.P Tanner
 
Impact!'s Avatar
 
Posts: 8,219
Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)Impact! puts the "bang" in Bangladesh (30,000+)
*Vince, Umaga, Armando, and Trump are in the ring*

Trump: Ok Vince, you want to know who I'm choosing to represent me at Wrestlemania. Well then let me introduce you to...MY HAIR

*Trumps hair piece jumps off and attacks Umaga*

J.R: BA GAWD KING, THAT HAIR PIECE AIN'T MADE OF CHOCOLATE

King: UMAGA'S HAVING A BAD HAIR DAY HA HAH

Trump: We'll see you at Wrestlemania Vincent
Impact! is offline   Reply With Quote
Old 02-22-2007, 03:05 AM   #2238
Vastardikai
Taller than Adam Cole
 
Vastardikai's Avatar
 
Posts: 10,876
Vastardikai makes a lot of good posts (200,000+)Vastardikai makes a lot of good posts (200,000+)Vastardikai makes a lot of good posts (200,000+)Vastardikai makes a lot of good posts (200,000+)Vastardikai makes a lot of good posts (200,000+)Vastardikai makes a lot of good posts (200,000+)Vastardikai makes a lot of good posts (200,000+)Vastardikai makes a lot of good posts (200,000+)Vastardikai makes a lot of good posts (200,000+)Vastardikai makes a lot of good posts (200,000+)Vastardikai makes a lot of good posts (200,000+)Vastardikai makes a lot of good posts (200,000+)Vastardikai makes a lot of good posts (200,000+)
Trump: (over the phone) Hello, Mr. Awesome, I'd like you to be...

(In runs an angry TPWWer who saw this coming)

Angry TPWWer: TOO SOON! TOO FUCKING SOON! FUCK YOU VASTARDIKAI!

Vastardikai: I was just gonna have Awesome say no and leave it at that. Wait a minute... you don't mean that Awesome is... NOOOOOOO!
Vastardikai is offline   Reply With Quote
Old 02-22-2007, 07:32 AM   #2239
Xero
He's Here
 
Xero's Avatar
 
Posts: 60,735
Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)Xero makes a lot of good posts (200,000+)
Trump: Vince, in WrestleMania, my pick is going to be...

*Lita's music hits*

Trump: LIT-

*Lita walks out and off the stage, breaking her leg.*

*Vince whispers to Trump*

Trump: Ok, ok... STEVIE RICHARDS!
Xero is offline   Reply With Quote
Old 02-23-2007, 04:39 PM   #2240
Disturbed316
 
Disturbed316's Avatar
 
Posts: 22,695
Disturbed316 has a relatively large amount of rep (50,000+)Disturbed316 has a relatively large amount of rep (50,000+)Disturbed316 has a relatively large amount of rep (50,000+)Disturbed316 has a relatively large amount of rep (50,000+)Disturbed316 has a relatively large amount of rep (50,000+)Disturbed316 has a relatively large amount of rep (50,000+)Disturbed316 has a relatively large amount of rep (50,000+)Disturbed316 has a relatively large amount of rep (50,000+)Disturbed316 has a relatively large amount of rep (50,000+)Disturbed316 has a relatively large amount of rep (50,000+)
*Trump, McMahon and Uuuuumaga are in the ring*

Trump: And my pick for wrestlemania is....STONE COLD STEVE AUSTIN!

Fan in front row: WHAT THE FUCK?

Thank you for ruining Austins return, thank you for ruining what would have been my only mark out moment in a year.

WHY THE HELL WOULD YOU TYPE "SPOILERS" WHEN YOU TYPE WHAT THE SPOILER IS RIGHT BESIDE IT!!!!!!!!!

Now I know Austin is confirmed, he is my favourite wrestler, hearing his damn music hit would have made me mark out so bad, but no, you have to fucking ruin it, couldn't you make the title "Wrestlmania 22 major spoilers" alone? Seriously man, use your goddam brain. Why mark for spoilers when the spoiler is right beside where you mark for spoilers.

Fuck this shit, you're not the only one who does it, so many people do, i am out of the fucking wrestling forum besides for tipsters until Wrestlemania is over, see you all April fourth.

Trump: Hmm, maybe not
Disturbed316 is offline   Reply With Quote
Reply

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is On

Forum Jump


All times are GMT -4. The time now is 05:53 PM.


Powered by vBulletin®